avatar
DNA

Guest 288 2nd Jan, 2024

MARKUP 1.80 KB
                                           
                         ACTGTGCTGACTCCCGGTGCTGCCGCTGCCATAGCTAAAGCCCGGGTCCTGGTAGGCAGGCGGGAAGCAG
GGTGGGGGTCCCGGGTACTGGTAGGGGTAGCCCTGACCCAGAGGCGGGGGGGCAGCCGGGTGGGGCAGCG
GGGCCAGCGTGTCCTGAA-CGAAGTCCCACTGGAGCCACTGTTGAGGTTCAGGGTGGCGAGATCTGGCGG
NNNAGGGTAGGTGAGGGCCGCGGAGGGGCCTCCGGCGTTCCCCTCCCCCCCGCCCTGAAACCCGAAGCCC
CCACTCACTGCTGCAGAGATCCCCTGAAAACGTAGTAGCACTGCTCgagacAGGTGATCTGTTGACCTGA
AACCGCAGGAAGCCGTGCTTCAGCAAGCTGCTGGCGTACTTCCGGGCCT---GCCGCTCCTTGAAGCCCT
CCACGTGTGTGTACAGCCAGTCCACCACGTCCGCCCCTGGCCGGCACCAGCGGTCAGCCCGCAGCCTCGA
GGCAAGCAGCCCTGCCNNTGGCACTATCCGC-CGCGGGGACGGCCACTCACCGATGACGGCATNNGCGAT
GGTGATCTTGAGCCACATGCGGTCGCGGATCTCCAGTCCCGAG---GGCAGCTGCATGACCCGGACGACG
GCGCTCATGTCACtcaccgtcagcggcgcctcttccagCCAGCTCTGCAAAGCACAGACAGCCCCGCTTC
GCCCCAGCATCTGAAAGCGGGGGACTCggcAcgCTGCACCCCCAGGGGAGCCTCTGGGCAGAGCCTGCGC
CAGGGCGCAAGCTGGACGGTGCGTGACAGCAGGGCCCCGGCCCACTGCAGGATGCACCCCCGTGAGGCTG
GGGCGTGAGCAGGGGGGTTGGACAtttAGTCTCCCACTTCTACAGACACTTTTCATCAGGATCCTAGGCA
CAAACTGGGCTGAAACCCCACCCTGCAGACCAGGAAGTAATGAGAACAGGGCAGGCCCCTTCCCCTCNNC
GCATGCC-CACCCGAGAGCGCAGGCTGTTAGTCGTGTTAATGGCAGGAAGCAGAATGGAGACCTGGCCCC
TGCCTCTGAA-CCGTGGGTGCTCaactggctaGCCCTACGTACATCCCCTGTTCcggCCAACACACAGAC
ATGAGCAGGATGGGCTGCACAAGGTGGGCACGGGTGCCTGTGCACACGTCTGTGCAGGGAGTTGGGGACA
GGCAACACACACGTGTCACAGCCCCATGACGGggcaattgcGCCATGCTGGCTGAATGGCAGAGACGCCC
CTCCAAGCCTCGGTTTCTGCTGGGGCCCTCAGGAGCTGCCACTTACGTGGAGCACCAGGCACGGAGCTGG
TTAGTGAGGAGGAGCTGGTGCGCGTGACGGCGCTGGAGCAGGGACTCGTACCGTAGCGGGGCAGGGCNNN
TGTCAGTGCCGCCGTGTGGtcagcggcgatCGGCG-GGTCGATGGGCCGCACCGGGTCAGCTGGGTGNAG
ACACGTGGCGATGACAGGCGGACAGATGGACAGGGTGGGAGGGCAGGGTGCAGGGCACAGAGGAGAGAGG
CCTTCAGGCTAGGTAGGCGCCCCCTCCCCATCCCGccccGTGTGCCCCGAGGGCCACTCACCCCGTGGGA
CGGTGAAGTAGCTTCG-GGCGTTGGGTCCAGCACTTGGCCACAGTGAGGCTGNAAATGGCTGCAGGAACG
GTGGTCCCCCCGCAAGGCCCCCATGGTCCCACCTCCCTGCCTGGCCCCTCCCGCTCCAGCGCCNCCAGCC
                      
                                       
To share this paste please copy this url and send to your friends
RAW Paste Data
Recent Pastes
Ta strona używa plików cookie w celu usprawnienia i ułatwienia dostępu do serwisu oraz prowadzenia danych statystycznych. Dalsze korzystanie z tej witryny oznacza akceptację tego stanu rzeczy.
Wykorzystywanie plików Cookie
Jak wyłączyć cookies?
ROZUMIEM